Leader CHIMP-L3G5SU
| Species | CHIMP |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | IMGT |
Exon 1 (52 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ACGGAGAAGCCCTTGGGAGTTTCATTCTTGATTTCCTCCTGGCAGCTGTGCTGGGTGAATAGA
Find similar leaders
Alleles with this leader
2 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.