AIRBabel immunoglobulin and T-cell receptor allele sequences · leaders · RSSs

Tutorial

Five worked examples using live AIRBabel records, each shown in the browser and through the REST API. The page also provides a runnable Python client. No account or API key is required.

1Are these two names the same allele?

A name is a label, not an identifier. Two names can denote one sequence, and one name can denote several unrelated sequences. Resolving both names to their Server UID, a hash of the sequence, settles it: the same Server UID denotes the same normalized nucleotide sequence.

  1. Search each name in Auto mode, with the species set. An exact match jumps straight to the record; without a species, a name several species reuse returns a picker instead.
  2. Compare the Server UID at the top of each page, not the names.

IGHV1-69*01 and IGHV1-69D*01 both resolve to HUMAN-VQLNRZF6P, one normalized nucleotide sequence with two IMGT names. So do IGKV1D-17*02 (a designation IMGT stopped using in 2015) and IGKV1-17*03, both HUMAN-VACLUDJCT. The converse also occurs: IGHV1-69*01 is also a live name in chicken, gorilla, mouse and rhesus, on different sequences, so an unscoped lookup must be told which species you mean.

# one name -> one record, scoped to a species
curl "/api/resolve?query=IGHV1-69D*01&species=human" | jq .record.native.uid
# which species reuse this name, and on which sequences?
curl "/api/search/name?q=IGHV1-69*01&exact=1"

2What full allele contains this sequence fragment?

User-supplied sequences may be partial: primer-trimmed, assembled short of the ends, or copied out of a figure. By default identity is scored over the full length, which penalises a fragment for the part it does not cover. Turn on partial match to score over the best-matching window instead, so a contained fragment resolves near 100%.

  1. Choose Sequence mode and paste the fragment; no name is needed.
  2. Tick Partial match.
  3. Read the Match column: substring means fully contained, no mismatches.

A 57 nt fragment resolves at 1.000, matched by substring, to IGHV1-18*01 and its close relatives. Several alleles contain it, all tied at 1.000, the expected result for a fragment of this length. The ranking tells you what the read could be, not what it must be; paste more sequence to separate them.

curl -X POST "/api/search/sequence?partial=true" \
  -H "content-type: application/json" \
  -d '{"sequence": "CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAG"}'

3What is the closest human allele to this mouse allele?

Allele names do not establish orthology across species; numbering schemes are independent. Sequence identity provides a comparable measure across species, computed all-against-all between species and cached, so the lookup is immediate.

  1. Open the mouse record and use Find similar alleles.
  2. In the species picker choose the target species; use Ctrl, or Cmd on macOS, to select several.
  3. Lower the minimum identity threshold: cross-species neighbours sit well below the same-species range.

Mouse IGHV5-17*01 (MOUSE-V3GPCFPTO) is closest to human IGHV3-48*01 at 88.2% nucleotide identity, with a different subgroup number in each species. Cross-species neighbours are served from the cache down to 85% identity.

curl "/api/sequences/MOUSE-V3GPCFPTO/similar?to_species=human&same_species=false&min_identity=0.8"

4Which protein does this nucleotide allele call encode?

Two V alleles that differ by a silent substitution encode the identical protein. For questions about the encoded receptor sequence, synonymous nucleotide differences should be interpreted at the protein level. Every V allele carries a protein UID derived from its amino-acid hash, shared by every allele that translates to the same V-REGION.

  1. Open the record and read Protein UID in the identity table.
  2. Use Find similar with amino acid and a threshold of 99% to list the alleles that share it.
  3. Or paste the amino-acid sequence directly in Amino acid mode.

IGHV3-25*05 (HUMAN-VOST4CB5R) and IGHV3-25*03 (HUMAN-V3VFNK4GI) differ at one nucleotide. The substitution is silent, so both carry protein UID HUMAN-VP-VFECCW and the amino-acid comparison returns 100%. Protein UIDs are V-only: D, J and C carry no translated sequence.

curl "/api/sequences/HUMAN-VOST4CB5R/similar?kind=aa&min_identity=0.999"

5Which alleles are supported by this PMID?

A record's reference list answers “which papers cite this allele?”. The reverse question, given a paper, which AIRBabel allele records are linked to it, is what you need when you are evaluating a claim or reproducing a reference set.

  1. Enter the PubMed ID in PMID mode (bare digits, PMID:29163486, or a PubMed URL; Auto mode also recognises bare digits).
  2. Read the evidence tier on each hit; the tiers are never summed into one number.

PMID 29163486 (Ramesh et al. 2017, the de novo rhesus macaque Ig loci) is linked to hundreds of AIRBabel records, all at the verified tier, carried by the MUSA rhesus set. Archived records are returned and flagged, because a paper citing a name that has since been retired is exactly the case where the citation must still lead somewhere.

An empty result is not negative evidence. Citation coverage is partial: it comes either from a source that publishes references with its records or from mining a paper's text and supplements. An empty result means AIRBabel holds no citation linking that paper to an allele, not that the paper describes none.

curl "/api/pmid/29163486"

Use AIRBabel from Python

The example client is a single Python file using only the standard library; no installation, dependency, or API key is required. Each function is independent. Run it as-is to see all six calls answer against this instance.

airbabel_example.py

Download
# against this instance
python airbabel_example.py 
#!/usr/bin/env python3
"""AIRBabel REST API — a runnable tour of the six things you'll actually do.

Standard library only: no install step, no API key, no registration.

    python airbabel_example.py                        # against the public server
    python airbabel_example.py http://127.0.0.1:8000  # against your own instance

Each function is independent — copy the one you need. Every call returns plain
JSON, so `json.load` is the whole client.

Data is aggregated from IMGT, OGRDB and published curated sets; attribute the
originating sources on reuse (see <BASE>/sources and <BASE>/api/export).
"""

from __future__ import annotations

import json
import sys
import urllib.error
import urllib.parse
import urllib.request

BASE = "https://airbabel.org"

# A 57 nt fragment of a human IGHV1-18 allele: the kind of partial sequence a
# primer-trimmed read or a figure in a paper actually gives you.
FRAGMENT = "CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAG"


def _call(path: str, params: dict | None = None, body: dict | None = None):
    """GET (or POST, when `body` is given) one endpoint and return parsed JSON.

    Raises on anything that is not 2xx, with the server's own message: the API
    answers 404 for "no such record" and 422 for "that is not a sequence / not a
    PMID", and those are answers worth reading rather than swallowing.
    """
    url = BASE.rstrip("/") + path
    if params:
        url += "?" + urllib.parse.urlencode(params)
    data = json.dumps(body).encode() if body is not None else None
    headers = {"content-type": "application/json"} if data else {}
    req = urllib.request.Request(url, data=data, headers=headers)
    try:
        with urllib.request.urlopen(req, timeout=60) as resp:
            return json.load(resp)
    except urllib.error.HTTPError as exc:
        detail = exc.read().decode("utf-8", "replace")[:400]
        raise RuntimeError(f"{exc.code} {exc.reason} for {url}\n{detail}") from exc


# --- 0. which build am I talking to? -------------------------------------------
# Record this next to any result you keep. `release` names the data; the digests make
# it checkable, and `similarity_digest` is what makes a reported % identity
# reproducible -- it pins the metric, the per-segment policy and the cache floors.

def dataset_version() -> dict:
    return _call("/version")


# --- 1. resolve a name ---------------------------------------------------------
# Any name, from any scheme or source, including names a reference set has since
# renamed or withdrawn. `matched_by` says how it matched; `species=` scopes a name
# that several species reuse.

def resolve_name(name: str, species: str | None = None) -> dict:
    params = {"query": name}
    if species:
        params["species"] = species
    return _call("/api/resolve", params)


# --- 2. resolve a nucleotide sequence ------------------------------------------
# Identity is the sequence hash, so an exact sequence match is exact regardless of
# what anyone calls it. `partial=true` scores over the best-matching window, which
# is what you want for a truncated read: a contained fragment scores ~1.0.

def resolve_sequence(seq: str, partial: bool = True, species: str | None = None) -> dict:
    params: dict = {"partial": str(partial).lower()}
    if species:
        params["species"] = species
    return _call("/api/search/sequence", params, body={"sequence": seq})


# --- 3. retrieve a sequence record ---------------------------------------------
# The full record: sequence, translated V-REGION, every name with its scheme and
# source, cross-references and literature evidence.

def get_record(uid: str) -> dict:
    return _call(f"/api/sequences/{uid}")


# --- 4. get similar alleles ----------------------------------------------------
# Ranked by % identity (normalised Levenshtein). `to_species` is the cross-species
# nearest-neighbour lookup: "the closest human alleles to this mouse one".

def find_similar(uid: str, min_identity: float = 0.9, kind: str = "nt",
                 to_species: str | None = None) -> dict:
    params: dict = {"min_identity": min_identity, "kind": kind}
    if to_species:
        params["to_species"] = to_species
        params["same_species"] = "false"
    return _call(f"/api/sequences/{uid}/similar", params)


# --- 5. AIRR AlleleDescription -------------------------------------------------
# The same record under AIRR field names, with species and sources as CURIEs —
# what you want when the output feeds an AIRR-compliant pipeline.

def airr_description(name_or_uid: str, species: str | None = None) -> dict:
    params = {"query": name_or_uid, "view": "airr"}
    if species:
        params["species"] = species
    return _call("/api/resolve", params)


# --- 6. query a PMID -----------------------------------------------------------
# The reverse of a record's reference list: given a paper, which sequences does it
# stand behind? Each hit carries its evidence tier (verified / sequence / name),
# and the per-tier totals are reported separately, never summed.

def alleles_for_pmid(pmid: str, species: str | None = None) -> dict:
    params = {"species": species} if species else None
    return _call(f"/api/pmid/{pmid}", params)


def main(base: str = BASE) -> None:
    global BASE
    BASE = base
    print(f"# AIRBabel at {BASE}")
    ver = dataset_version()
    ds = ver.get("dataset")
    if ds:
        print(f"# dataset release {ds['release']}  "
              f"content {ds['content_digest'][:12]}…  "
              f"distance {ds['similarity_digest'][:12]}…")
        if not ds["similarity_current"]:
            print("# WARNING: the server's distance parameters have changed since it "
                  "was stamped; scores are not the ones this release describes.")
    else:
        print("# dataset: unstamped -- cite the access date, not a version")
    print()

    hit = resolve_name("IGHV1-69*01", species="human")
    native = hit["record"]["native"]
    uid = native["uid"]
    print(f"1. resolve name  IGHV1-69*01 -> {uid}  "
          f"({native['species']} {native['locus']} {native['length']} nt, "
          f"matched_by={hit['matched_by']})")
    print("   names:", ", ".join(n["name"] for n in native["allele_names"]))

    # A name a reference set stopped using still resolves, because former
    # designations hang off the sequence hash rather than off the name.
    old = resolve_name("IGKV1D-17*02")
    print(f"   retired name IGKV1D-17*02 -> {old['record']['native']['uid']}")

    res = resolve_sequence(FRAGMENT, partial=True)
    top = res["hits"][0]
    print(f"\n2. resolve sequence  {len(FRAGMENT)} nt fragment -> {res['count']} hits; "
          f"best {top['label']} ({top['uid']}) at {top['score']:.3f} [{top['matched_by']}]")

    rec = get_record(uid)["native"]
    print(f"\n3. record  {uid}  protein_uid={rec.get('protein_uid')}  "
          f"functional={rec.get('functional')}")

    sim = find_similar(uid, min_identity=0.95, kind="nt")
    print(f"\n4. similar (nt, >=95%, same species): {sim['count']}")
    for h in sim["hits"][:5]:
        print(f"     {h['score']:.3f}  {h['uid']}  {h['label']}")

    # Cross-species: the closest human alleles to a mouse allele.
    cross = find_similar("MOUSE-V3GPCFPTO", min_identity=0.8, to_species="human")
    print(f"   mouse IGHV5-17*01 -> closest human: {cross['count']}")
    for h in cross["hits"][:3]:
        print(f"     {h['score']:.3f}  {h['uid']}  {h['label']}")

    # Scope to a species: IGHV1-69*01 is a live name on a *different* sequence in
    # chicken, gorilla, mouse and rhesus, so an unscoped resolve is entitled to
    # answer with any of them. This is the whole point of the service, and it bites
    # scripts first.
    airr = airr_description("IGHV1-69*01", species="human")
    print(f"\n5. AIRR AlleleDescription  label={airr['label']}  "
          f"locus={airr['locus']}  species={airr['species']['id']}  "
          f"aliases={airr['aliases']}")

    pm = alleles_for_pmid("29163486")
    print(f"\n6. PMID {pm['pmid']}: {pm['count']} alleles attested "
          f"(verified {pm['n_verified']}, sequence {pm['n_sequence']}, "
          f"name-only {pm['n_name']})")
    print(f"   {pm['url']}")


if __name__ == "__main__":
    main(sys.argv[1] if len(sys.argv) > 1 else BASE)

Every endpoint the script uses is documented in the API reference, with the interactive Swagger UI and the raw OpenAPI schema alongside. Bulk download of the whole dataset is at /api/export; attribution terms and per-source citations are on Sources & citations.