HUMAN-VACLUDJCT
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGK / V |
| Functional i | True |
| Length | 287 nt |
| Protein UID i | HUMAN-VP-VJX5MB (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (HUMAN-VACLUDJCT). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV1-65SI*09 | IgLabel | HUSA |
| IGKV1-17*03 | IMGT | IMGT, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| KM455566.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGKV1D-17*02 | 2013-01-20 |
External records i
NCBI nucleotide: link GenBank: GENBANK:KM455566 GenBank: GENBANK:KM455566.1 IMGT: IGKV1-17*03 OGRDB: IGKV1-17*03
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 25338678 | Sequencing of the human IG light chain loci from a hydatidiform mole BAC library reveals locus-specific signatures of genetic diversity. | verified | ncbi_nucleotide |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 30697215 | VH1-69 Utilizing Antibodies Are Capable of Mediating Non-neutralizing Fc-Mediated Effector Functions Against the Transmitted/Founder gp120. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 33485405 | Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. | name mentioned* | literature_supp |
| 34587480 | Paired heavy- and light-chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses. | name mentioned* | literature_supp |
| 35347236 | Mouse and human antibodies bind HLA-E-leader peptide complexes and enhance NK cell cytotoxicity. | name mentioned* | literature_supp |
| 35383174 | Efficient human-like antibody repertoire and hybridoma production in trans-chromosomic mice carrying megabase-sized human immunoglobulin loci. | name mentioned* | literature_supp |
| 35397794 | A large-scale systematic survey reveals recurring molecular features of public antibody responses to SARS-CoV-2. | name mentioned* | literature_supp |
| 35447092 | Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | name mentioned* | literature_supp |
| 38205245 | Comprehensive characterization and database construction of immune repertoire in the largest Chinese glioma cohort. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 38844673 | Resolving haplotype variation and complex genetic architecture in the human immunoglobulin kappa chain locus in individuals of diverse ancestry. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by HUSA, IMGT, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTTACACACCCGAACATAAACC | HUSA IMGT | HUMAN-RI4XC5 |
| v_rs | CACAGTGTTACACACCCAAACATAAACC | HUSA | HUMAN-RQCZPV |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTGCCAGGTGT | 49 + 11 nt | IMGT | HUMAN-L6L3YQ |
| ATGGACATGAGGGTCCCCACTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTGCCAGGTGT | 55 + 11 nt | HUSA | HUMAN-LCTTUU |
| ATGGACATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTGCCAGGTGT | 55 + 11 nt | HUSA | HUMAN-LHEAQY |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VACLUDJCT/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases