Leader COW-LBCH7Z
| Species | COW |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (61 nt) |
| Sources | IMGT |
Exon 1 (53 nt)
Genomic intron, deferred
Exon 2 (8 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
61 nt
ATGTGCTTCAGCCTTCTGTGCTGTGCGGCTTTTTGTTTTCTTTTGGGGAGCAGGCTCCATG
Find similar leaders
Alleles with this leader
3 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| TRBV21-1*01 | COW | TRB | IMGT | COW-VFGJT6BB7 |
| TRBV21-13*01 | COW | TRB | IMGT | COW-VOVV652T3 |
| TRBV21-7*01 | COW | TRB | IMGT | COW-VKHZLPU3C |