Leader COW-LR542O
| Species | COW |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | IMGT |
Exon 1 (51 nt)
Genomic intron, deferred
Exon 2 (8 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ACGAAGGGGCTAGCAGGCACTGTGCTGGGGCTTTGTTTGCCCAGGTTTCCTGTGTGCAA
Find similar leaders
Alleles with this leader
2 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| TRAV22-5*01 | COW | TRA | IMGT | COW-V3KQD4QAZ |
| TRAV22-5*02 | COW | TRA | IMGT | COW-VLYRCQ74N |