Leader COW-LVUB54
| Species | COW |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (42 nt) |
| Sources | IMGT |
Exon 1 (31 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
42 nt
ATGCTGGTGCTTCTGCTGCTTCTGGGACCCAGCTCTGGGCTT
Find similar leaders
Alleles with this leader
5 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| TRBV20-1*01 | COW | TRB | IMGT | COW-VQIMBYR3T |
| TRBV20-2*01 | COW | TRB | IMGT | COW-VTRZQ3MGG |
| TRBV20-3*01 | COW | TRB | IMGT | COW-VV43WTM5L |
| TRBV20-4*01 | COW | TRB | IMGT | COW-VRSV7XMWD |
| TRBV20-5*01 | COW | TRB | IMGT | COW-VJGR5A3PR |