Leader COW-LYGQS7
| Species | COW |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (60 nt) |
| Sources | IMGT |
Exon 1 (49 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
60 nt
ATGCTTCTCTCCAGCCTTCTGAAGGTGGTCGTGGCTTCACTGTGTTTAGGATCCAGTATT
Find similar leaders
Alleles with this leader
3 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| TRAV14-2*01 | COW | TRA | IMGT | COW-VPAN22KXK |
| TRAV14-4*01 | COW | TRA | IMGT | COW-VA6PN4BWX |
| TRAV14-4*02 | COW | TRA | IMGT | COW-V46BF5SJ7 |