Leader HUMAN-L5UBGV
| Species | HUMAN |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (56 nt) |
| Sources | IMGT |
Exon 1 (49 nt)
Genomic intron, deferred
Exon 2 (7 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
56 nt
ATGACTGTTGGCAGCATATTACGGGCACTCATGGCCTCTGCCTTCCTTGCATGTCA
Find similar leaders
Alleles with this leader
3 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.