Leader RAT-LCC5LW
| Species | RAT |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (68 nt) |
| Sources | IMGT |
Exon 1 (54 nt)
Genomic intron, deferred
Exon 2 (14 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
68 nt
ATGTTGTTTTGTTTGCTTAGAACCCCTATACCTGGTGACTTTTCCACGCTGTAAGTTCCTTGTAGAGG
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV2-69*01 | RAT | IGH | IMGT | RAT-V57WBDJ6X |