Leader RHESUS-L2ARLJ
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (68 nt) |
| Sources | MUSA |
Exon 1 (57 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
68 nt
ATGGACATGAGGGTCCCTGCTCAGCTCCTGGGGCTCCTACTGCTCTGGCTCCCAGGTGTGCCAGATGT
Find similar leaders
Alleles with this leader
2 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGKV1-5SWL*01_a75g_a112g_a113g | RHESUS | IGK | MUSA | RHESUS-VIAYWWQVO |
| IGKV1-5SWL*01_a112g_a113g_a198t | RHESUS | IGK | MUSA | RHESUS-VGE2IVUCO |