Leader RHESUS-L32HH3
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (62 nt) |
| Sources | MUSA |
Exon 1 (51 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
62 nt
ATGGAAGCCCCAGCACAGCTTCTCTTCCTCCTGCTTCTCTGGCTCCCAGGTGTACCACCGGA
Find similar leaders
Alleles with this leader
3 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGKV3-6P57*08_t87c_g106a_g107a_c114g_c319a | RHESUS | IGK | MUSA | RHESUS-VW26INMLR |
| IGKV3-6P57*08_t87c_g106a_g107a_c114g_a271g_c319a | RHESUS | IGK | MUSA | RHESUS-VICAM42IM |
| IGKV3-6P57*06_t210c_a271g_c319a | RHESUS | IGK | MUSA | RHESUS-V3KAR6RD7 |