Leader RHESUS-L6MDZY
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | MUSA |
Exon 1 (48 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ATGGACTGGACCTGGAGGATCCTCCTCTTGGTGGCAGCAGCCACAGGTGTGCCCAGGCC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV1-JHF7*01_t11a_a40c_a63c_c78t_c90t_g106a_a107g_110ctgtt114_c120g_c139g_g147c_g151c_g159a_t163c_a169t_a170g_c189t_g210c_g239c_a240g_a246g_g249c_a263g_321ca322 | RHESUS | IGH | MUSA | RHESUS-VNWMR3LAO |