Leader RHESUS-LDIOV4
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (62 nt) |
| Sources | MUSA |
Exon 1 (51 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
62 nt
ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGCTCCCTGGTGGTCCAGTAGG
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGKV2-5HMW*01_c15a_g18a_c35t_g54a_i59tgt_a61t_t62c_c74g_c87t_t89c_g90a_c91t_t93c_g104a_t114c_c126t_t157c_g166t_a167t_g168t_c195a_g208c_t216a_a229c_g251a_c277t_g286a_g301a_t310c_g319a_g320a_c325g | RHESUS | IGK | MUSA | RHESUS-VGFKJK6QD |