Leader RHESUS-LGJHN4
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | MUSA |
Exon 1 (48 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ATGGCCTGGACTCCTCTCCTCCTCCTGCTCCTCTCTCACTGCACAGGTGTTCCCTGTCA
Find similar leaders
Alleles with this leader
4 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGLV5-276Q*03_c15t_a21g_a22g_g42t_c53t_g65c_a76c_g80c_a106g_t108c_a112t_g113a_t163a_g191a_a291g | RHESUS | IGL | MUSA | RHESUS-VDF76TEG2 |
| IGLV5-276Q*03_c15t_a21g_a22g_g42t_c53t_g65c_a76c_g80c_a106g_t108c_a112t_g113a_t163a_g191a_a291g_c322t | RHESUS | IGL | MUSA | RHESUS-VREHQ3KQ6 |
| IGLV5-276Q*03_c15t_g42t_c53t_g65c_a76c_g80c_a106g_t108c_a112t_g113a_t163a_g191a_a291g | RHESUS | IGL | MUSA | RHESUS-V2GUZLPMA |
| IGLV5-276Q*06_a21g_a22g_c53t_g80c_g89a_a106g_t108c_a112t_g113a_g114c | RHESUS | IGL | MUSA | RHESUS-VXDIRW4WQ |