Leader RHESUS-LHP3NM
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | MUSA |
Exon 1 (48 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ATGGCCTGCTTTCCTCTCGTCCTCACCCTCCTCACTCACTGTGCAGGTGATCCTGGGCC
Find similar leaders
Alleles with this leader
2 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGLV1-24UP*07_a18g_g37a_c42t_c66t_t114c_t118a_a201g_a207g_t222c_g255c_g278a_a284g_a286c_c288t_c314a_318ccca321_t327c_g329a_g337a_a340c | RHESUS | IGL | MUSA | RHESUS-VXKZIMXGB |
| IGLV1-24UP*07_a18g_g37a_c42t_c66t_t114c_t118a_a201g_t222c_g255c_g278a_a284g_a286c_c288t_c314a_a318c_t319c_g320c_t327c_g329a_g337a_a340c | RHESUS | IGL | MUSA | RHESUS-VBYKKBLM7 |