Leader RHESUS-LHZNAD
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (17 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ATGGGGTTTGAACCAAGCTGAATTTTTCTTGTTGTTATTTTCAAAGTTGCAGGTTTTCAGTGT
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-6JOO*03_g13a_g15t_21cata24_g26a_a27g_g32a_t34c_g37a_t38g_g42a_g49a_g50a_t52c_c53t_c63t_c71t_t78c_g79a_a85g_t89g_109ttgt112_g114a_a117t_a119g_121caag124_c126t_g128a_a129c_c134g_g144a_a145g_g151c_g156a_159aata162_a164g_c165t_g171a_c174t_g190c_a194t_a197g_t199c_t203g_c209a_c223a_a229t_t231c_g239a_a240g_c249t_c258g_c261g_c276t_c279t_c296t_a297g_301--------------------320 | RHESUS | IGH | MUSA | RHESUS-VTD3PWOFN |