Leader RHESUS-LLK2WY
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | IMGT |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (17 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ATGAAGCACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGGGTCCTGTCCCAGCTG
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV4-81*01 | RHESUS | IGH | IMGT | RHESUS-VS2T2M7P7 |