Leader RHESUS-LMEPZY
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | MUSA |
Exon 1 (48 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ATGACCTGGTTCCCTCTCCTGCTCACCCTTCTCATTCACTGCACAGGTGGTCCTGGGCC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGLV18-FO3T*06_g15a_g21a_c38a_c39t_c57a_a109t_g110a_g133c_g144a_c154-_t155-_c156-_167gtgcc171_t201c_g204t_a207g_t219c_t220c_a244c_t252c_t262a_c264g_g268a_c275a_a284g_a286c_g290a_a291g_t294c_t300g | RHESUS | IGL | MUSA | RHESUS-VLRISX7AZ |