Leader RHESUS-LMSBOZ
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | MUSA |
Exon 1 (48 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ATGGGGTCCACCGTCACCCTCGCCCTCCTCCTGGCTGTTCTCCAAGGTGTGTCTCTGCC
Find similar leaders
Alleles with this leader
6 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV5-T2J5*01_297---------------------------------------335 | RHESUS | IGH | MUSA | RHESUS-VRHR4ZCW5 |
| IGHV5-T2J5*01_a24t_t251c_297---------------------------------------335 | RHESUS | IGH | MUSA | RHESUS-VWECJ5QPF |
| IGHV5-T2J5*01_g139a_297---------------------------------------335 | RHESUS | IGH | MUSA | RHESUS-VU2BZSEYZ |
| IGHV5-T2J5*02_297---------------------------------------335 | RHESUS | IGH | MUSA | RHESUS-VQQCX6NG3 |
| IGHV5-T2J5*02_c19t_a24t_a203g_297---------------------------------------335 | RHESUS | IGH | MUSA | RHESUS-VBU5O4GIQ |
| IGHV5-T2J5*02_c19t_a24t_g128a_a203g_297---------------------------------------335 | RHESUS | IGH | MUSA | RHESUS-V4E473LV3 |