Leader RHESUS-LOFXZD
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (63 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (17 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
63 nt
ATGGGACAGCCTCTGGGCTGCACATGAGGAGGGCTCCCTCCCCACGTCCATGGGAACGTCAAC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-N72G*01_6-----10_14atcg17_20tcttt24_g26a_a27t_c33a_t35a_g37t_t38a_c39t_a41c_g42c_t45a_g46a_c47a_g49t_g50c_g51t_c54t_56---ca60_t64-_t69c_c71t_a73t_t76c_t78g_a81t_t82c_a85t_c87a_t88g_c90g_104caagtg109_a115g_t116g_g118a_a119g_c127t_i137ggg_a138g_a142g_a143g_a163g_c172a_a174t_g182c_g191a_c194g_a197g_g216c_c223t_c237-_a238-_a245g_c281t_g289a_a297g_300------------ca313_a316t | RHESUS | IGH | MUSA | RHESUS-V33UX77VL |