Leader RHESUS-LR3ZDN
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (56 nt) |
| Sources | MUSA |
Exon 1 (45 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
56 nt
ATGACCTGGTCCCCTCTCCTCACCCTTCTCATTCACTGCACAGGTGGTCCTGGGCC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGLV18-SRE7*02_c38a_a200g_t219c_t220c_c221t_c229a_a258c_g259a_g275c_c300t_c336t | RHESUS | IGL | MUSA | RHESUS-VWQEWTLVE |