Leader RHESUS-LRDGGW
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (62 nt) |
| Sources | MUSA |
Exon 1 (51 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
62 nt
ATGTGGCTCCCTGCTCAGCTCCTGGGGCTGCTGGTGCTCTGGGTCCCTGGGGATCCAGTGGC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGKV2-54DC*02_c27t_g30c_g37t_c53t_c88g_c91g_t93c_a100g_g118t_a119g_t120c_c127t_t161c_i169tct_193tttt196_t198c_g200t_g202t_a203t_a204t_t231c_g251a_c252g_c261t_a270g_c286g_t297a_t300a_g301t_t314c_a325c_g328c_a329t_c333a_335c335 | RHESUS | IGK | MUSA | RHESUS-V44FQ7VAZ |