Leader RHESUS-LRME3H
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (59 nt) |
| Sources | MUSA |
Exon 1 (48 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
59 nt
ATGGCCTGGACCCCTCCCCTGCTCACCCTCCTCACTCTCTGCACAGGTGCTCTGTGGTT
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGLV3-BR3M*04_t3c_a13g_a27g_t28g_g43t_g44t_c50t_a51g_t53c_a72g_c78t_a79g_c82a_c84a_a85g_g107a_t111c_t114c_g115a_g119a_a125g_g144a_c149t_t150a_g153a_c154g_t155g_g160a_t161c_a164g_a169-_a170-_c171-_c205t_g207t_g228c_c229a_g230a_g245a_c246a_g251a_a252g_c255g_c257a_a258g_t261c_t262a_c263t_t265c_g280a_t287a_g288t_g297a_t300c_g311t_g313-_a314-_317atcac321_c336t_342cacagtgacatcactcatcc361 | RHESUS | IGL | MUSA | RHESUS-V76GYWSHD |