Leader RHESUS-LT5WEX
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (57 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
57 nt
ATGGTCATGAGGTATTAAGGTCTTCTCTTTTTTTTTATTGTTTTCTGTTTTCAGTGT
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV3-ZJGS*01_g13a_g15t_t21c_g22a_g23c_g26a_a27g_g32a_c33t_t34c_g37a_t38g_t39a_g42a_g49a_g50a_c53t_a60t_c71t_t78c_g79a_g112t_c114a_c118a_a119g_g123a_c126t_g128a_c130a_g133a_t154g_g156a_g159a_g160a_c161t_a163g_t164a_t169-_t171a_a191g_a194t_t199c_c201t_c203t_t210a_c213g_c223a_a229t_c231g_g239a_t247g_c249t_a256t_a258g_c268a_c279t_c280t_t281g_c288t_a291g_c296t_301--------------------320 | RHESUS | IGH | MUSA | RHESUS-VGFNEUS36 |