Leader RHESUS-LT65NU
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (57 nt) |
| Sources | MUSA |
Exon 1 (46 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
57 nt
ATGAGGAGCGTGCTCTGAAGGGGCTTATTTTTCAGTCAAAGGACCTGCGCCCACTCC
Find similar leaders
Alleles with this leader
1 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGHV1-4B2U*03_c6g_a18g_c21t_g31t_a38g_c44g_a49-_c61g_c69t_a72t_g73t_c74t_t81g_a83t_c86t_t88a_t89c_t90c_c105a_t112a_a113g_a118c_t125c_a127c_t146g_g151a_t167a_t168c_c172t_c194g_g197t_g202a_c203a_a204g_g207a_c213t_c214a_g226c_c231t_c251g_t255c_a256t_t266c_g267a_c271t_a275g_g291a_307--------------320 | RHESUS | IGH | MUSA | RHESUS-VPQNMVERH |