Leader RHESUS-LZBLLS
| Species | RHESUS |
|---|---|
| Type | Leader signal-peptide coding sequence, spliced exon 1 plus exon 2 (68 nt) |
| Sources | MUSA |
Exon 1 (57 nt)
Genomic intron, deferred
Exon 2 (11 nt)
Signal-peptide coding sequence (exon 1 shown in bold). The genomic intron between exon 1 and exon 2 is deferred.
68 nt
ATGGACATGAGGGCCCCCGCTCAGCTCCTGGAGCTCCTGTTGCTCTGGCTCACAGGTGTGCCAGATGT
Find similar leaders
Alleles with this leader
4 coding allele(s) carry this exact leader. The Source column shows which source recorded each allele–leader pairing.
| Allele name | Species | Locus | Source of this allele–leader link | Server UID |
|---|---|---|---|---|
| IGKV1-ACWK*01_a2c_t32c_g33a_t40a_t64a_g72t_c74t_a75g_t106a_t108c_g110a_g120c_155----------164_g166t_g201t_g206c_a255g_a274g_a308t_g315a_g325a_a328t_c329a | RHESUS | IGK | MUSA | RHESUS-V4UZUFEIW |
| IGKV1-ACWK*01_a2c_t32c_t40a_g53c_a61c_t64a_g72t_c74t_a75g_t106a_t108c_g110a_g120c_155----------164_g166t_g201t_g206c_a255g_a274g_a308t_g315a_g325a_a328t_c329a_c331a | RHESUS | IGK | MUSA | RHESUS-VDPTHN73V |
| IGKV1-ACWK*01_a2c_t32c_t40a_t64a_g72t_c74t_a75g_t106a_t108c_g110a_g120c_155----------164_g166t_g201t_g206c_a255g_a274g_a308t_g315a_g325a_a328t_c329a | RHESUS | IGK | MUSA | RHESUS-V3KJCPEZ5 |
| IGKV1-ACWK*01_a2c_t32c_t40a_t64a_g72t_c74t_a75g_t106a_t108c_g110a_g120c_155----------164_g166t_g201t_g206c_a255g_a274g_c302a_a308t_g315a_g325a_a328t_c329a | RHESUS | IGK | MUSA | RHESUS-VVXDIFTMT |