RSS PIG-R45AI5
| Species | PIG |
|---|---|
| Type | J-RS · complete signal, 5' of J (39 nt) |
| Sources | IMGT |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
GGTTTTTATAGAAGTGGAAGTTAAGGGGAAATCGCTATG
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGKJ3*01 | PIG | IGK | IMGT | PIG-J5GN7I2KV |