RSS RAT-RDEVXQ
| Species | RAT |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | IMGT |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACACTGACACAGCCTCAGTTTTCAGCTGTACAGTATTT
Find similar RSS
Alleles with this RSS variant
4 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHV8-21*01 | RAT | IGH | IMGT | RAT-VZPSOGM5L |
| IGHV8-28*01 | RAT | IGH | IMGT | RAT-V7SL6QJ3V |
| IGHV8-29*01 | RAT | IGH | IMGT | RAT-VIHPSWCM2 |
| IGHV8-31*01 | RAT | IGH | IMGT | RAT-V6PW6NLWK |