RSS RHESUS-R32ZAY
| Species | RHESUS |
|---|---|
| Type | J-RS · complete signal, 5' of J (28 nt) |
| Sources | MUSA |
Heptamer
Spacer (12 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
28 nt
GGTTTGTATCCAAGCATAATTCACTGAA
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLJ9-PIRL*01_i0gcatg_c5t_g9a_a10g_g11c_a18c_g23c_c26t_a27g_c29t_c30t | RHESUS | IGL | MUSA | RHESUS-JSXGJCBB7 |