RSS RHESUS-R3PDMD
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | MUSA |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACAGTGAAACAGGCAGATGAGGAGATTAGACAAATACA
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV3-BR3M*04_t3c_a13g_a27g_t28g_g43t_g44t_c50t_a51g_t53c_a72g_c78t_a79g_c82a_c84a_a85g_g107a_t111c_t114c_g115a_g119a_a125g_g144a_c149t_t150a_g153a_c154g_t155g_g160a_t161c_a164g_a169-_a170-_c171-_c205t_g207t_g228c_c229a_g230a_g245a_c246a_g251a_a252g_c255g_c257a_a258g_t261c_t262a_c263t_t265c_g280a_t287a_g288t_g297a_t300c_g311t_g313-_a314-_317atcac321_c336t_342cacagtgacatcactcatcc361 | RHESUS | IGL | MUSA | RHESUS-V76GYWSHD |