RSS RHESUS-R5OFTN
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (40 nt) |
| Sources | MUSA |
Heptamer
Spacer (24 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
40 nt
AACTGTGCATTACTATATGTGAGGCACTAGGTAAGAAGAC
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHV3-6JOO*05_t5a_g6a_g24a_g26a_a27g_g32a_34ccaag38_g42a_c44a_g46a_g73a_c84a_a109t_c110a_a112t_g114a_a119g_g122c_g123c_126ttcc129_a145g_g156a_g159a_c161t_t162a_c165t_a169t_t172g_a186t_g188a_g190c_a194t_a197g_c198t_t203c_g205c_c207a_g211-_g220a_c223a_g224c_g239a_c243a_c258a_t262c_c265t_c276t_c279t_t288a_a293-_297------------------------320 | RHESUS | IGH | MUSA | RHESUS-V6STJZRK3 |