RSS RHESUS-R5TM22
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (38 nt) |
| Sources | MUSA |
Heptamer
Spacer (22 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
38 nt
GATGGTGAGGATGGGTGAGCCACAGTGACACAAAGAAG
Find similar RSS
Alleles with this RSS variant
5 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV27-CPNX*01_337--------------------356 | RHESUS | IGL | MUSA | RHESUS-VV6NKHPI3 |
| IGLV27-CPNX*01_a45g_337--------------------356 | RHESUS | IGL | MUSA | RHESUS-V6ESYAN4N |
| IGLV27-CPNX*01_a45g_a205g_337--------------------356 | RHESUS | IGL | MUSA | RHESUS-VHXLPKOKQ |
| IGLV27-CPNX*01_c121t_337--------------------356 | RHESUS | IGL | MUSA | RHESUS-VHXFR6LAA |
| IGLV27-CPNX*01_g122a_337--------------------356 | RHESUS | IGL | MUSA | RHESUS-VLSBZEJIG |