RSS RHESUS-RDAGJU
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | MUSA |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACAGTGACACACACAGATGGGGAAGTGGGACAAAAACT
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV5-276Q*03_c15t_a21g_a22g_g42t_c53t_g65c_a76c_g80c_a106g_t108c_a112t_g113a_t163a_g191a_a291g_c322t | RHESUS | IGL | MUSA | RHESUS-VREHQ3KQ6 |
| IGLV5-276Q*06_a21g_a22g_c53t_g80c_g89a_a106g_t108c_a112t_g113a_g114c | RHESUS | IGL | MUSA | RHESUS-VXDIRW4WQ |