RSS RHESUS-RDLULT
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (28 nt) |
| Sources | MUSA |
Heptamer
Spacer (12 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
28 nt
CACAGTGATACAACCCCGAACAGAAACC
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGKV2-54DC*02_c27t_g30c_g37t_c53t_c88g_c91g_t93c_a100g_g118t_a119g_t120c_c127t_t161c_i169tct_193tttt196_t198c_g200t_g202t_a203t_a204t_t231c_g251a_c252g_c261t_a270g_c286g_t297a_t300a_g301t_t314c_a325c_g328c_a329t_c333a_335c335 | RHESUS | IGK | MUSA | RHESUS-V44FQ7VAZ |