RSS RHESUS-RE6YOC
| Species | RHESUS |
|---|---|
| Type | 5'D-RS · complete signal, 5' of D (29 nt) |
| Sources | MUSA |
Heptamer
Spacer (13 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
29 nt
GATTTCTCAGTTCTGCCATGGGGATACTG
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHD5-75EJ*01_i0gag_a7c_a9g_g10a_c11a_a13g_g15t_g16t_19cag21 | RHESUS | IGH | MUSA | RHESUS-DVI7OC5X7 |
| IGHD6-64ZP*01_i0gaggt_a5c_7gaat10_g14t_g15t_18ag19 | RHESUS | IGH | MUSA | RHESUS-DZNJCT37N |