RSS RHESUS-RF53I3
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (37 nt) |
| Sources | MUSA |
Heptamer
Spacer (21 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
37 nt
AACTAAGTAATGGGAAGTCAGTGTGAGACAAGACACA
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHV3-2UXX*04_g1a_2ctta5_c7t_c10t_g12c_g13a_a17t_c20a_23tgtcc27_g31t_g32a_t34c_37tcat40_g49a_c53t_c55t_a58c_g68a_g112t_c114a_c118a_a119g_c120g_g123a_g128a_c134t_g141a_g151a_g153t_g156a_g159a_c161t_t164a_g165t_t169a_t171g_g175a_a194t_c201t_g205c_g211c_a221g_c222t_c223a_c231t_a232g_c234a_g239a_g241t_c243a_c248t_a250g_a256t_262-------------------280_288-----292_c294a_c296t_t307c_g315t_a316t | RHESUS | IGH | MUSA | RHESUS-VFUASUD6K |