RSS RHESUS-RHFSWY
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | MUSA |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACAGTGACAGACTCATAAGAGGAACCAAGACAAAAACC
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV7-22ZI*01_a28c_g71c_c72t_a109c_g155c_c165t_a166g_a200g_g231c_a282g_c288t_g295a_t319c_336g336 | RHESUS | IGL | MUSA | RHESUS-VW2APNEYC |
| IGLV7-22ZI*01_a28c_g71c_c72t_a109c_g155c_c165t_a166g_a200g_g231c_a282g_c288t_g295a_c312t_t314g_t319c_336g336 | RHESUS | IGL | MUSA | RHESUS-VS47LOW33 |