RSS RHESUS-RI3CKR
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | MUSA |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACAGTGAGGCGAGGTCAGTGTGAGCCCACACAAACCTC
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHV9-4BFW*05_a8g_a24g_g61c_t109c_c237a | RHESUS | IGH | MUSA | RHESUS-VEG3MNTZU |