RSS RHESUS-RJYQBL
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (28 nt) |
| Sources | MUSA |
Heptamer
Spacer (12 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
28 nt
CACAATGGCACAGTCCCTTAGAGAAACC
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGKV2-5HMW*01_c15a_g18a_c35t_g54a_i59tgt_a61t_t62c_c74g_c87t_t89c_g90a_c91t_t93c_g104a_t114c_c126t_t157c_g166t_a167t_g168t_c195a_g208c_t216a_a229c_g251a_c277t_g286a_g301a_t310c_g319a_g320a_c325g | RHESUS | IGK | MUSA | RHESUS-VGFKJK6QD |