RSS RHESUS-RNQ4NU
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | MUSA |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACAGTGCTCCAGACCCACAGGGAAGTGAGAGAAAAACC
Find similar RSS
Alleles with this RSS variant
4 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV21-6YH6*03_c72t_g112a_a220g_a224g_g320t | RHESUS | IGL | MUSA | RHESUS-VVE6J4BZF |
| IGLV21-6YH6*03_g112a_a220g_a224g_a331g_t332c | RHESUS | IGL | MUSA | RHESUS-VMC3CJCSI |
| IGLV21-6YH6*03_g112a_a224g_c245g_g260a_g271a_a331g_t332c | RHESUS | IGL | MUSA | RHESUS-VF6JMJEIL |
| IGLV21-6YH6*03_t6a_g112a_a224g_g260a_g271a_a331g_t332c | RHESUS | IGL | MUSA | RHESUS-VTNMB2G4R |