RSS RHESUS-RNT2ER
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (38 nt) |
| Sources | MUSA |
Heptamer
Spacer (22 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
38 nt
CACAGTGCTCCAGACTCATAGAGAAGTGAGCAAAAAGC
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV21-NBMT*01_c1a_2gtct5_c16g_c19t_a44g_t50c_c78t_g83a_g89a_t93c_g103a_g104a_g107t_t113g_g115a_a119c_c120t_a134g_g143a_c144t_a145c_c148t_c149t_g152a_g177c_a190g_g191t_c206a_a210g_a319c_g338c | RHESUS | IGL | MUSA | RHESUS-V3F4FJYVH |