RSS RHESUS-ROFCPI
| Species | RHESUS |
|---|---|
| Type | 5'D-RS · complete signal, 5' of D (29 nt) |
| Sources | MUSA |
Heptamer
Spacer (13 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
29 nt
GGCCTCAGTGAGACCCCCAAAAGACCCTG
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHD12-7HR7*02_g1c_t2a_a3g_c4t_g9c_a12g_t16c_a18t_t19a_22aga24 | RHESUS | IGH | MUSA | RHESUS-DV42EQOTW |
| IGHD12-7HR7*02_g1c_t2a_a3g_c4t_g9c_a12g_t16c_a18t_t19a_22agaaaatatgt32 | RHESUS | IGH | MUSA | RHESUS-DV72OEZ2T |