RSS RHESUS-RTITDF
| Species | RHESUS |
|---|---|
| Type | 3'D-RS · complete signal, 3' of D (27 nt) |
| Sources | MUSA |
Heptamer
Spacer (11 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
27 nt
CCCTGACTGGTGGCCCCACAACACACC
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHD5-X76R*01_i0gagcagtgaactgga_t2c_g3c_g4c_t6g_a9t_g12a_t15g_t20a_t21g_24cagccgctgacatcccgagc43 | RHESUS | IGH | MUSA | RHESUS-DPLSNGCDY |
| IGHD5-X76R*01_i0gagctgtgaactgga_t2c_g3c_g4c_t6g_a9t_g12a_t15g_t20a_t21g_24cagccgctgacatcccgagc43 | RHESUS | IGH | MUSA | RHESUS-DLYOFVTC3 |