RSS RHESUS-RTLOMD
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (40 nt) |
| Sources | MUSA |
Heptamer
Spacer (24 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
40 nt
TACCGTGGTGGCACTGTGTGCATCTCTGACTTCAGGGACA
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHV3-6HY2*02_g3c_g22t_g23t_g31a_g37t_a39g_c40t_g50c_g51a_c53a_c55g_c63t_t67c_g68t_c90t_a103t_c108g_t118a_a119g_g128a_g144a_g155a_c163t_g164t_a166t_t168g_g175a_a176g_g186a_a187g_t189c_c201t_a204g_c210t_g211c_c222t_g224c_g243t_a244g_c246t_c255a_g267a_a271g_t279c_t280c_c294t_c296g_a297t_307--------------320 | RHESUS | IGH | MUSA | RHESUS-VBARS5PQZ |