RSS RHESUS-RWVMPP
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (28 nt) |
| Sources | MUSA |
Heptamer
Spacer (12 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
28 nt
CACAGTGTTACAAGTCATAACGTAAACC
Find similar RSS
Alleles with this RSS variant
1 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGKV1-436A*06_g53c_a70c_g71a_a138g_t295g_333tcc335 | RHESUS | IGK | MUSA | RHESUS-VMWEDMXHI |