RSS RHESUS-RWY6ZS
| Species | RHESUS |
|---|---|
| Type | 3'D-RS · complete signal, 3' of D (29 nt) |
| Sources | MUSA |
Heptamer
Spacer (13 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
29 nt
CATAGTTTGTGAATATCTTCACCCATTCT
Find similar RSS
Alleles with this RSS variant
3 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHD4-ZLQB*01_i0cctggatatt_t1g_a6t_a11c_13gacg16 | RHESUS | IGH | MUSA | RHESUS-DFA7K5YA4 |
| IGHD4-ZLQB*01_i0cctggatttt_t1g_a6t_a11c_13gaca16 | RHESUS | IGH | MUSA | RHESUS-DXGGIOLSN |
| IGHD6-UTCO*01_i0cct_g3a_a7t_c9a_g11c_c12t_a14c_16atcagacg23 | RHESUS | IGH | MUSA | RHESUS-DR6RWGP3G |