RSS RHESUS-RYNIHF
| Species | RHESUS |
|---|---|
| Type | V-RS · complete signal, 3' of V (39 nt) |
| Sources | MUSA |
Heptamer
Spacer (23 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
39 nt
CACAGTGCTCCAGGCCCAGGGAGAAGTGAGATAAGAACC
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGLV1-24UP*07_a18g_g37a_c42t_c66t_t114c_t118a_a201g_a207g_t222c_g255c_g278a_a284g_a286c_c288t_c314a_318ccca321_t327c_g329a_g337a_a340c | RHESUS | IGL | MUSA | RHESUS-VXKZIMXGB |
| IGLV1-24UP*07_a18g_g37a_c42t_c66t_t114c_t118a_a201g_t222c_g255c_g278a_a284g_a286c_c288t_c314a_a318c_t319c_g320c_t327c_g329a_g337a_a340c | RHESUS | IGL | MUSA | RHESUS-VBYKKBLM7 |