RSS RHESUS-RYUDKT
| Species | RHESUS |
|---|---|
| Type | 5'D-RS · complete signal, 5' of D (27 nt) |
| Sources | MUSA |
Heptamer
Spacer (11 nt)
Nonamer
RSS spacer length determines pairing under the 12/23 rule, so it follows the locus rather than the segment: a 12 nt RSS recombines with a 23 nt RSS.
27 nt
GGATCAGGTTAATGTTACCCCACTGTG
Find similar RSS
Alleles with this RSS variant
2 coding allele(s) linked to this exact RSS. The Source column shows which source recorded each allele–RSS pairing. Source coverage of allele to RSS pairings is source-specific.
| Allele name | Species | Locus | Source of this allele–RSS link | Server UID |
|---|---|---|---|---|
| IGHD1-C7RJ*01_i0aagtgggct_c1g_a4c_g8a_g9t_11ggc13 | RHESUS | IGH | MUSA | RHESUS-DQD34S36K |
| IGHD1-RIPD*05_i0aagtg_3ctgt6_t9a_g10t_a13t_c14g_a16g | RHESUS | IGH | MUSA | RHESUS-DULXZYSFC |