CAT-VDBPJ4FEW
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRDV2*01: a Felis catus TRD V allele sequence, 167 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Felis catus (NCBITAXON:9685) |
|---|---|
| Locus / type | TRD / V |
| Functional i | None |
| Length | 167 nt |
| Protein UID i | CAT-VP-K7KYPG (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: formerly TRDV2-2*01 (to 2020-01-31);
Allele names i
Every name below denotes this exact sequence (CAT-VDBPJ4FEW). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRDV2*01 | IMGT | IMGT |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| TRDV2-2*01 | 2020-01-31 |
External records i
IMGT: TRDV2*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 22792299 | Unbiased analysis of TCRα/β chains at the single-cell level in human CD8+ T-cell subsets. | name mentioned* | literature_supp |
| 23957733 | Fine mapping of V(D)J recombinase mediated rearrangements in human lymphoid malignancies. | name mentioned* | literature_supp |
| 27528257 | Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human. | name mentioned* | literature_supp |
| 35432299 | Durable Expansion of TCR-δ Meta-Clonotypes After BCG Revaccination in Humans. | name mentioned* | literature_supp |
| 37056780 | Impact of BCG vaccination on the repertoire of human γδ T cell receptors. | name mentioned* | literature_supp |
| 38762584 | Invariant γδTCR natural killer-like effector T cells in the naked mole-rat. | name mentioned* | literature_supp |
| 40244697 | Single-cell transcriptional analysis reveals allergen-specific signatures in human γδ T cells. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40866291 | Spatial TCR clonality and clonal expansion in the in situ microenvironment of non-small cell lung cancer. | name mentioned* | literature_supp |
| 41021035 | The protective role of γδ T cells in endometrial cancer. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGACAAAGGTGTGCTCCCTCATCCATCTCACCCTCTTCTGGACAGTCACA | 46 + 5 nt | IMGT | CAT-LZT353 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/CAT-VDBPJ4FEW/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases