CHIMP-V4ABQCT5L
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRBV10-3*01: a Pan troglodytes TRB V allele sequence, 287 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Pan troglodytes (NCBITAXON:9598) |
|---|---|
| Locus / type | TRB / V |
| Functional i | None |
| Length | 287 nt |
| Protein UID i | CHIMP-VP-ZETF5H (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (CHIMP-V4ABQCT5L). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRBV10-3*01 | IMGT | IMGT |
External records i
IMGT: TRBV10-3*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 40205052 | Complete sequencing of ape genomes. | sequence in paper | literature_supp |
| 22792299 | Unbiased analysis of TCRα/β chains at the single-cell level in human CD8+ T-cell subsets. | name mentioned* | literature_supp |
| 26962778 | High Throughput Sequencing of T Cell Antigen Receptors Reveals a Conserved TCR Repertoire. | name mentioned* | literature_supp |
| 30152754 | Human T cell receptor occurrence patterns encode immune history, genetic background, and receptor specificity. | name mentioned* | literature_supp |
| 30541895 | Autoimmunity to hypocretin and molecular mimicry to flu in type 1 narcolepsy. | name mentioned* | literature_supp |
| 31237075 | Comparative analysis of CDR3 regions in paired human αβ CD8 T cells. | name mentioned* | literature_supp |
| 34845983 | TCR meta-clonotypes for biomarker discovery with tcrdist3 enabled identification of public, HLA-restricted clusters of SARS-CoV-2 TCRs. | name mentioned* | literature_supp |
| 35436998 | pmTR database: population matched (pm) germline allelic variants of T-cell receptor (TR) loci. | name mentioned* | literature_supp |
| 36408799 | SARS-CoV-2-specific CD4+ and CD8+ T cell responses can originate from cross-reactive CMV-specific T cells. | name mentioned* | literature_supp |
| 38871688 | Germline-like TCR-α chains shared between autoreactive T cells in blood and pancreas. | name mentioned* | literature_supp |
| 38878776 | Quantifiable TCR repertoire changes in prediagnostic blood specimens among patients with high-grade ovarian cancer. | name mentioned* | literature_supp |
| 38954022 | Identification and validation of tumor-specific T cell receptors from tumor infiltrating lymphocytes using tumor organoid co-cultures. | name mentioned* | literature_supp |
| 39133650 | Expansion of the HSV-2-specific T cell repertoire in skin after immunotherapeutic HSV-2 vaccine. | name mentioned* | literature_supp |
| 39421738 | scRNA+TCR-seq reveals the pivotal role of dual receptor T lymphocytes in the pathogenesis of Kawasaki disease and during IVIG treatment. | name mentioned* | literature_supp |
| 39472557 | Physiological and pathogenic T cell autoreactivity converge in type 1 diabetes. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40775219 | Integrative multi-omics reveals a regulatory and exhausted T-cell landscape in CLL and identifies galectin-9 as an immunotherapy target. | name mentioned* | literature_supp |
| 40866291 | Spatial TCR clonality and clonal expansion in the in situ microenvironment of non-small cell lung cancer. | name mentioned* | literature_supp |
| 41150899 | Large-Scale T-cell Receptor Repertoire Profiling Unveils Tumor-Specific Signals for Diagnosing Indeterminate Pulmonary Nodules. | name mentioned* | literature_supp |
| 41407706 | Resistance potential of the HLA-A2-restricted immunodominant SARS-CoV-2-specific CD8+ T cell receptor repertoire to antigenic drift. | name mentioned* | literature_supp |
| 41424382 | Identification of Sjögren's disease-associated T cell receptor motifs through deep sequencing. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTGCATGGCTGCCTCCTCTCTGCACGTAAACA | IMGT | CHIMP-RJPUIO |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGCACAAGGTTCTTCTTCTATGTGGCCCTTTGTCTCCTGTGGACAGGACACATG | 49 + 8 nt | IMGT | CHIMP-LFBAK6 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/CHIMP-V4ABQCT5L/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases